martine roussel (Addgene inc)
Addgene inc is a verified supplier 
93
Structured Review
Addgene inc
martine roussel
Martine Roussel, supplied by Addgene inc, used in various techniques. Bioz Stars score: 93/100, based on 18 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/martine+roussel/pCDNA3-HA-HA-humanCMYC+(Plasmid+%2374164)/pmc12288966-147-56-72
Average 93 stars, based on 18 article reviews
Martine Roussel, supplied by Addgene inc, used in various techniques. Bioz Stars score: 93/100, based on 18 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/martine+roussel/pCDNA3-HA-HA-humanCMYC+(Plasmid+%2374164)/pmc12288966-147-56-72
Average 93 stars, based on 18 article reviews
martine roussel - by Bioz Stars,
2026-09
93/100 stars
Images
Related Articles
Generated:Article Title: The F-box protein FBXL16 up-regulates the stability of C-MYC oncoprotein by antagonizing the activity of the F-box protein FBW7 Article Snippet: .. FBXL16ΔLRR was generated by replacing I244 with a stop codon using FBXL16I244Stop-F (ACGCTCAGCGAGGTCTAGCGCGCGCTCAG GC) and its reverse complement. pCDNA3-HA-cmyc was a gift from Plasmid Preparation:Article Title: The F-box protein FBXL16 up-regulates the stability of C-MYC oncoprotein by antagonizing the activity of the F-box protein FBW7 Article Snippet: .. FBXL16ΔLRR was generated by replacing I244 with a stop codon using FBXL16I244Stop-F (ACGCTCAGCGAGGTCTAGCGCGCGCTCAG GC) and its reverse complement. pCDNA3-HA-cmyc was a gift from Article Title: Optogenetic clustering and membrane translocation of the BcLOV4 photoreceptor. Article Snippet: .. ErbB2 was sourced from MSCV- human Erbb2- IRES- GFP, which was a gift from Article Title: Emerin is an effector of oncogenic KRAS-driven nuclear dynamics in pancreatic cancer Article Snippet: Primers were obtained from IDT (WT = 349 bp, Emd +/– = 490/349 bp, Emd –/– = 490 bp). .. Empty vector, pcDNA-HA2 was a gift from Scott Kaufmann (Division of Oncology Research, Department of Oncology, Mayo Clinic). pcDNA- CYCLIN D1 -T286A-HA was a gift from Bruce Zetter (Vascular Biology and Department of Surgery, Children’s Hospital, Harvard Medical School, Boston, Massachusetts, USA) (RRID: Addgene 11182) ( ). cMyc plasmid, pCDNA3-HA-HA-human CMYC , was a gift from Article Title: Early transcriptional and epigenetic divergence of CD8+ T cells responding to acute versus chronic infection. Article Snippet: Single-Cell RNA libraries were prepared according to the 10x Genomics Chromium Single-Cell 30 Reagent Kits v2 User Guide or Next GEM Single Cell 30 Reagent kits v3.1 User Guide and sequenced on a HiSeq 4000 (Illumina). .. The MSCV-mouse-Ezh2-IRES-GFP (Ezh2 overexpression, Ezh2-OE) vector was a gift from Article Title: Lentiviral-Driven Discovery of Cancer Drug Resistance Mutations Article Snippet: The HIV reverse transcriptase (RT)–M230I mutant (M-RT) was generated by sitedirected mutagenesis of codon 230 (ATG!ATC) in the RT in the plasmid pCMV-dR8.91 with the Q5 Site-Directed Mutagenesis Kit (New England BioLabs, catalog no. E0554S). .. The BCR-ABL1 open reading frame was PCR amplified from the plasmid MSCV-(pBabemcs)-humanp210BCR-ABL-IRES-GFP that was a gift from other:Article Title: LEFTY1 Is a Dual-SMAD Inhibitor that Promotes Mammary Progenitor Growth and Tumorigenesis. Article Snippet: REAGENT or RESOURCE SOURCE IDENTIFIER Software and Algorithms ImageJ ImageJ RRID:SCR_003070 GraphPad Prism GraphPad Software RRID:SCR_002798 CopyCaller software v2.1 Thermo Fisher Scientific https://www.thermofisher.com/us/en/ home/technical-resources/softwaredownloads/copycaller-software.html MATLAB (version 7.3.0.267 (R2006b) MathWorks RRID:SCR_001622 R v3.6.0 RStudio RRID:SCR_000432 ELDA: extreme limiting dilution analysis Webtool http://bioinf.wehi.edu.au/software/elda/ Article Title: LEFTY1 Is a Dual-SMAD Inhibitor that Promotes Mammary Progenitor Growth and Tumorigenesis. Article Snippet: REAGENT or RESOURCE SOURCE IDENTIFIER Recombinant EGF Thermo Fisher Scientific Cat# PMG8043 Recombinant Noggin R&D Systems Cat# 6057-NG Growth Factor Reduced Matrigel BD Biociences Cat# 356230 Matrigel BD Biociences Cat# 356234 LEFTY-1 R&D Systems Cat# 994-LF BMP7 R&D Systems Cat# 5666-BP BMP2 R&D Systems Cat# 355-BM BMP4 R&D Systems Cat# 314-BP CRIPTO-1 R&D Systems Cat# 1538-CR NODAL R&D Systems Cat# 1315-ND Recombinant Human TGF-beta 1 Protein R&D Systems Cat#240-B-002 DAPI Sigma-Aldrich Cat# 32670 Dispase StemCell Technologies Cat#07913 Collagenase/Hyaluronidase StemCell Technologies Cat #07912 DNase I solution StemCell Technologies Cat#07900 Lefty Blocking Peptide Santa Cruz Biotechnolgy Cat# sc-365845 P LDN-193189 Selleckchem Cat# S2618 Critical Commercial Assays Dual-Luciferase Reporter Assay System Promega Cat#E1910 DUOLink Sigma Cat#921021 Pierce CO-IP Kit Thermo Fisher Scientific Cat#26147 Experimental Models: Cell Lines HEK293T ATCC Cat# CRL-3216, RRID:CVCL_0063 MDA-MD-157 ATCC Cat# HTB-24, RRID:CVCL_0618 3T3-L1 feeder cells Kindly provided by Dr. Nusse N/A L1-wnt3a feeder cells Kindly provided by Dr. Nusse N/A MDA-MB-231 ATCC Cat# HTB-26, RRID:CVCL_0062 COMMA-D beta cells Kindly provided by Dr. Medina Campbell et al., 1988 Experimental Models: Organisms/Strains C57BL/6 mice Jackson Laboratory Cat# JAX:000664, RRID:IMSR_JAX:000664 NOD.Cg-Prkdcscid Il2rgtm1Wjl/SzJ (NSG) Jackson Laboratory Cat# JAX:005557, RRID:IMSR_JAX:005557 pCx-GFP Kind gift of Dr. Irving Weissman N/A Oligonucleotides Cloning primers This paper Table S6 qRT-PCR primers This paper Table S6 Copy number determination primers This paper Table S6 Single cell assay ID This paper Table S3 Recombinant DNA pEIZ-HIV-ZsGreen Kind gift of Dr. Zena Werb N/A HIV-Lefty1-ZsG This paper N/A HIV-Che Shimono et al., 2009 N/A HIV-Bmp7-Che This paper N/A pGL3 BRE-luciferase Kind gift of Over Expression:Article Title: Early transcriptional and epigenetic divergence of CD8+ T cells responding to acute versus chronic infection. Article Snippet: Single-Cell RNA libraries were prepared according to the 10x Genomics Chromium Single-Cell 30 Reagent Kits v2 User Guide or Next GEM Single Cell 30 Reagent kits v3.1 User Guide and sequenced on a HiSeq 4000 (Illumina). .. The MSCV-mouse-Ezh2-IRES-GFP (Ezh2 overexpression, Ezh2-OE) vector was a gift from Polymerase Chain Reaction:Article Title: Lentiviral-Driven Discovery of Cancer Drug Resistance Mutations Article Snippet: The HIV reverse transcriptase (RT)–M230I mutant (M-RT) was generated by sitedirected mutagenesis of codon 230 (ATG!ATC) in the RT in the plasmid pCMV-dR8.91 with the Q5 Site-Directed Mutagenesis Kit (New England BioLabs, catalog no. E0554S). .. The BCR-ABL1 open reading frame was PCR amplified from the plasmid MSCV-(pBabemcs)-humanp210BCR-ABL-IRES-GFP that was a gift from Amplification:Article Title: Lentiviral-Driven Discovery of Cancer Drug Resistance Mutations Article Snippet: The HIV reverse transcriptase (RT)–M230I mutant (M-RT) was generated by sitedirected mutagenesis of codon 230 (ATG!ATC) in the RT in the plasmid pCMV-dR8.91 with the Q5 Site-Directed Mutagenesis Kit (New England BioLabs, catalog no. E0554S). .. The BCR-ABL1 open reading frame was PCR amplified from the plasmid MSCV-(pBabemcs)-humanp210BCR-ABL-IRES-GFP that was a gift from |